광명의 처소는 어느 길로 가며 흑암의 처소는 어디냐 [욥기 38:19]
창조의 신비
성경과 기독교
노아의 홍수
생명복제와 UFO
천문학
물리학 수학 환경
지질학
화석
진화론
진화론의 주장
창조론
연대문제
압도적인 노아 홍수
의 지질학적 증거들
사람과 공룡이 함께
살았다는 증거들
부정되고 있는 수십
억년의 지구연대
정확무오한 하나님의
말씀인 성경
만물에 깃든 창조주
의 능력과 신성
진화를 부정하는
살아있는 화석들
진화론의 허구적
증거와 주장
첫 방문자를 위한
창조과학 추천자료
ICR
AiG
Impact Article
CMI
Creation Magazine
Encyclopedia
Technical Journal
CEH
Headlines
CRSQ
Omniology
CSC
Bible.ca
RAE
 
DNA와 단백질 HOME > 자료실 > DNA와 단백질
정크 DNA가 기능이 있음이 또 다시 확인되었다.
: 모티프라 불리는 DNA의 직렬반복과 유전자 발현
(Junk DNA…Trashed Again)
Jeffrey P. Tomkins

   사람 유전체(human genome)에 들어있는 30억 개의 염기서열에서 반복되고 있는 '단어(word)'는 절반 이상이나 된다.[1] 언어에서 반복되는 단어는 오류로 보고 있기 때문에, 인간적인 생각으로 이러한 DNA 염기서열은 의미 없는 쓰레기(junk)로서 간주됐었다. 세속적 과학자들은 오랜 기간에 걸친 자연적 과정이 어떻게든 오류의 중복을 만들었고, 이러한 오류들이 쓸모없는 짐이 되어 유전체에 남아있어 전달되고 있다고 가정했었다. 그러나 이제 이러한 반복적인 단어들은 여러 생화학적 기능과 연결되어 있는 것으로 밝혀졌다.[1]

최근 뉴스에서 강조되고 있는, 사람 유전체(human genome) 염기서열에서 반복되고 있는 부분은 직렬반복(tandem repeats, TRs)이라 불리는 것이다. 이들은 모티프(motif)라 불리는, 머리-꼬리 패턴으로 배열된 '단어'의 두 개 또는 그 이상의 연속된 복사로 구성된 DNA의 확장 부분이다. 예를 들어, TR 'ttacttacttacttacgttac'은 단지 네 개의 모티프 'ttac'가 5회 반복되고 있다. 놀랍게도, 이러한 TRs는 유전자 안쪽, 바깥쪽, 심지어 유전자의 단백질 암호 부위 내부까지, 사람 유전체의 모든 부분에서 발견된다. 사람 각 개인별로 많은 TRs 들의 반복되는 길이는 다양하다. 그것은 법의학에서 범인이나, 친부모를 확인하는 데에 매우 효과적인 DNA 표지자(DNA markers)로서 사용되어왔다.

과학자들이 이 TR 시퀀스에 대해 알고 있었음에도 불구하고, 그리고 그것들을 신뢰할 수 있는 유전자 표지자로 사용해왔음에도 불구하고, 그것들의 실제적 기능에 대해서는 거의 알지 못하고 있었다. 언뜻 보기에 조금 이해되지 않는, 이들 비정상 같은 반복되는 염기서열 부분은 역사적으로 종종 ‘정크 DNA(junk DNA, 쓰레기 DNA)’로 취급되어 왔었다.

그러나 최근 한 그룹의 연구자들은 다른 접근 방식을 취했고, 이러한 서열이 어떤 목적을 가지고 있을 수도 있다는 가설을 세웠다. 그들은 유전자 발현과 DNA의 후성 유전학적 변화(epigenetic modification)에 있어서 TRs의 효과를 시험해보기 위한 실험 세트를 개발했다. 후성 유전학적 변화는 실제의 DNA 염기서열을 변경하지 않고, DNA 분자에 분자적 꼬리표(tags)를 추가하는 것이다. 그 결과 유전자 발현(gene expression)이 변경된다.

현재의 그리고 새롭게 얻어진 일련의 데이터들을 사용한 광범위한 실험을 실시한 후에, 연구자들은 ”우리의 결과는 사람 유전체에 있는 수천의 TR 변이들이 아마도 국소적 유전자 발현의 변경, 또는 후성유전학(epigenetics)을 통해서 기능적 효과를 발휘하고 있을 가능성을 제시한다”고 선언했다. 그들은 또한 이렇게 말했다 :

우리의 연구는 사람 유전체에서 TR 변이(TR variations)의 생물학적 중요성을 보여주고 있다. 그리고 TR 변이의 상당 부분이 국소적 유전자 발현이나, 후성유전학의 변경을 통해서 기능적 효과를 발휘하고 있음을 제시한다. 우리는 유전체에서 완전한 기능적 변화를 확인하기 위해서, 유전자형(유전자 시험) TR 변이에 초점을 맞춘 연구들이 필요하다는 결론을 내린다.[1]

이러한 새로운 데이터는 인간의 질병과 관련한 TRs의 기능적 역할에 대한 증거들을 밝혔던 다양한 이전 연구들을 확증해주고 있었다. 이것이 입증됨으로서, 수십 가지의 사람의 유전질환들은 유전체의 단백질 암호 또는 비암호 부위에서 커다란 반복적 확장과 직접적으로 연결되어 있을 수 있다.[2] 분명히, 이들 부위는 엄격한 유전적 조절 하에 있다. 그러한 반복이 허용되는 변이의 길이 한계를 넘었을 때, 질환이 생기는 결과를 초래할 수 있다.

다시 한 번 우리는 유전체에서, 한때 과학자들이 그 기능을 알지 못한다는 사실 만으로, 진화 도중에 남겨진, 기능이 없는 정크(쓰레기)라고 불렀던 DNA의 부분들이 분명한 기능들을 가지고 있다는 사실을 확인할 수 있었다. 진화론자들은 이해하지 못하고 알지 못하는 부분들에 대해서 적절한 답을 가지고 있는 것처럼 추정적인 이야기들을 남발해 왔었다.  

유전체 연구에 있어서, 지적설계에 기초한 접근 방식이 더 널리 받아들여졌었다면, 현재에도 알지 못하는 기능들에 대한 우리의 이해가 얼마나 많이 발전해 있었겠는가? 그러한 시도들은 초월적 지혜를 가지신, 위대한 설계자이자 공학자이신, 창조주 하나님께 영광을 돌렸을 것이다.


References

1. Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 (8): 3750-3762.
2. Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477.

*Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.


출처 : ICR News, 2016. 5. 26.
URL : http://www.icr.org/article/9352
번역자 : 미디어위원회

관련 자료 링크:

1. 유전체 내의 바이러스성 정크라는 허튼 소리 (Viral Genome Junk Is Bunk)
2. 당신의 심장 박동을 유지하는 정크 DNA. ('Junk' DNA Keeps Your Heart Beating)
3. 일부 정크 DNA는 단백질 생성의 시동을 걸고 있었다. (Novel 'Junk DNA' Sequences Jumpstart Protein Production)
4. 정크 DNA는 정말로 쓸모없을까? : 유사유전자를 통하여 본 정크(junk) DNA의 놀라운 기능들 (Is junk DNA useless? : The marvelous functions of pseudogenes)
5. 정크 DNA 패러다임에 도전한 한 젊은 과학자. (How One Bright Young Scientist Challenged the Junk-DNA Paradigm)
6. 유전체의 정크는 세포의 항공 교통 관제관이었다. (Genomic Junk Is Cell’s Air-Traffic Control)
7. 동물들은 우연히 쓰레기로부터 생겨났는가? (Animals from Junk by Chance)
8. 일부 정크 DNA는 신경세포 통로를 만드는 중요한 안내자였다. (Some Junk DNA Is Important Guide For Nerve-cell Channel Production)
9. 정크 DNA에서 더 많은 중요한 역할들이 발견되었다. (More 'Candy Found' in Junk DNA)
10. 후성유전학적 암호는 이전의 생각보다 훨씬 더 복잡했다. (Epigenetic Code More Complicated Than Previously Thought)
11. 후성유전체 연구는 세포에서 교향악단을 발견했다. (Epigenome Project Finds Symphony in Cells)
12. 사람과 침팬지의 유전자 차이는 더욱 커졌다. : 각 생물에만 있는 고아유전자들은 진화론을 거부한다. (Genetic Gap Widens Between Humans and Chimps)
13. 2015년 노벨 화학상으로 부각된 세포의 DNA 손상 복구 메커니즘은 진화론을 거부한다. (2015 Nobel Prize Highlights Cell Repair Mystery)
14. 사람 유전체는 4차원의 세계로 되어 있다. (Human Nucleome Reveals Amazing 4D World)
15. 3차원적 구조의 DNA 암호가 발견되다! : 다중 DNA 암호 체계는 진화론을 기각시킨다. (Three-Dimensional DNA Code Defies Evolution)
16. 유전자의 이중 암호는 진화론을 완전히 거부한다. : 중복 코돈의 3번째 염기는 단백질의 접힘과 관련되어 있었다. (Dual-Gene Codes Defy Evolution...Again)
17. 섬모충의 유전체는 극도로 복잡했다. 1 (Ciliate Genome Reveals Mind-Bending Complexity)
18. 진화론자들이 진화론을 기각시키고 있었다. : 단백질의 진화는 불가능하다! (Oops! Evolutionists Disproving Evolution)
19. 사람 단백질체는 “이전의 생각보다 훨씬 더 복잡했다” : 비암호 DNA 영역에서 수백 종의 단백질들이 만들어진다. (Human Proteome 'More Complex than Previously Thought')
20. 선도적 과학자들이 진화론을 비판하다. 3부. : 세포 내의 유전정보는 증가되지 않고, 소실되고 있다. (Powerhouse of Scientists Refute Evolution, Part Three)
 
 
“외계인의 침입: 속임수를 폭로하다” 영화가 개봉된다. (Alien I...
수백 개의 익룡 알들이 홍수 퇴적물에서 발견되었다. (Amazing Fos...
<리뷰> 돌연변이 : 진화의 원료?...
하나의 특별한 우주 : 그 개념...
호박 내로 생물이 포획되는 과정...
전 지구적 대홍수, 격변적 판구...
“화학적 진화”의 관점에서 본 ...
우리는 우주의 어디에 위치하는가...
양자화 된 적색편이 값은 우리...
성경에서 가장 중요한 구절 : ...
수십억 년의 연대를 받아들여서는...
아담과 이브의 혈액형은? (It's...
진화론을 비판하는 3,000 명의 ...
여리고의 성벽 : 고고학적 확...
생물의 진화적 기원이 불가능한 ...
다이아몬드 내의 방사성탄소는 수...

과학실험 큐티3
김형기 저

과학실험 큐티2
김형기 저

종교가 되어버린 진화라는 상상
정재훈 저

과학실험 큐티3
김형기 저

빅뱅과 5차원 우주창조론
권진혁 저

영화 속 진화론 바로잡기
교과서진화론개정추진회 저